CBSE Class 12 Biology 2025: question 31(a)
Set in the CBSE Class 12 board exam of 2025, paper 57/7/1, section E, question 31(a), for 5 marks. Try it first; the hints and our step-by-step solution are below.
Q31(a) · 5 marks · Long answerMolecular Basis of Inheritance
Write the features a molecule should have to act as a genetic material. In the light of the above features, evaluate and justify the suitability of the molecule that is preferred as an ideal genetic material.
Source: official question paper from cbse.gov.in (PDF). See it in the full 2025 board paper, set 57/7/1.
Hints
Open one hint at a time and try again before the next.
Hint 1
List what any genetic material must do: copy itself, stay stable, change slowly and express itself.
Hint 2
Compare the sugar (2′-OH vs 2′-H), the bases (T vs U) and the strandedness of DNA and RNA.
Step-by-step solution
Each step shows the marks it earns, as an examiner would award them. Checked by an independent re-solve from the question paper.
- ½ mark
Feature 1: it should be able to make its own copy (replication).
- ½ mark
Feature 2: it should be chemically and structurally stable.
- ½ mark
Feature 3: it should allow slow changes (mutation), which evolution requires.
- ½ mark
Feature 4: it should be able to express itself in the form of 'Mendelian characters'.
- 1 mark
Comparison 1 (stability): DNA is double-stranded, and its complementary strands can rejoin after separating. RNA has a reactive 2′-OH group in every nucleotide, which makes it labile and easily degraded, while DNA has 2′-H. Also, the thymine in DNA (in place of uracil) adds to its stability. So DNA is chemically less reactive and more stable.
- 1 mark
Comparison 2 (mutation and expression): RNA is catalytic and reactive, and it mutates faster than DNA. DNA mutates slowly enough to allow evolution without too much instability. Both can replicate by complementary base pairing, and both can express characters, though DNA needs RNA for protein synthesis.
- 1 mark
Conclusion: DNA is more stable and mutates at a suitable slow rate, so it is preferred for storing genetic information. RNA is better suited to transmitting and expressing it.
Answer: The four features are replication, stability, slow mutation and Mendelian expression. DNA (double-stranded, 2′-H, thymine, less reactive, slower mutation) is more stable than RNA, so DNA is the preferred genetic material.
Where the marks are
- Four features of a genetic material (½ × 4 = 2 marks)
- Any two valid DNA vs RNA comparisons, e.g. 2′-OH reactivity, thymine vs uracil, double strand, mutation rate (1 × 2 = 2 marks)
- Concludes that DNA is the preferred genetic material (1 mark)
Revise the chapter
- Chapter: Molecular Basis of Inheritance (notes, formulas, where marks are lost and every past question)
More questions from Molecular Basis of Inheritance
- Sample paper 2024-25, Q18(A) · 2 marksThe schematic representation given below shows a DNA strand and two types of mutations in the DNA strand. (i) …
- Sample paper 2024-25, Q18(B) · 2 marksGiven below is a schematic representation of a mRNA strand 5' AGGAGGUAUGAUCUCGUAAAAUAAA 3' (i) In the above se…
- Sample paper 2024-25, Q24 · 3 marksThe schematic representation given below shows the concept of Central Dogma. A. During the process of replicat…
The question is transcribed from the official paper; figures are described in words. The solution, hints and chapter tag are ours. Spotted an error? Write tosupport@questionbuddy.in.