Skip to content

Given below is a… (Class 12 Biology SQP 2024-25, Q18B)

questionbuddy.in/q/cbse-12-biology-2024-25-sqp-q18b-schematic-representation-mrna-strand

BiologyCBSE Class 12 · Sample paper, session 2024-25 · 2 marks · Very short answer

CBSE Class 12 Biology sample paper 2024-25: question 18(B)

From the official CBSE sample question paper for 2024-25, section B, question 18(B), for 2 marks. Try it first; the hints and our step-by-step solution are below.

Q18(B) · 2 marks · Very short answerCompetency-basedMolecular Basis of Inheritance

Given below is a schematic representation of a mRNA strand
5' AGGAGGUAUGAUCUCGUAAAAUAAA 3'

(i) In the above sequence identify the translational unit in mRNA.
(ii) Where are UTRs found and what is their significance?

Figure in the paper: A line labelled mRNA from 5' to 3' with the base sequence AGGAGGUAUGAUCUCGUAAAAUAAA written below. See it in the official paper.

Source: official sample paper from cbseacademic.nic.in (PDF). See it in the full Sample paper 2024-25.

Hints

Open one hint at a time and try again before the next.

Hint 1

Look for the start codon AUG in the sequence.

Hint 2

Read in triplets from AUG until you reach a stop codon (UAA, UAG or UGA).

Hint 3

The bases left over on either side are the UTRs.

Step-by-step solution

Each step shows the marks it earns, as an examiner would award them. Checked by an independent re-solve from the question paper.

  1. (i) The translational unit is the stretch from the start codon AUG to the stop codon UAA, which codes for a polypeptide:

    5′ AGGAGGU AUG AUC UCG UAA AAUAAA 3′

    Translational unit = AUG AUC UCG UAA.

    1 mark

  2. (ii) UTRs (untranslated regions) are found at the 5′ end, before the start codon (AGGAGGU here), and at the 3′ end, after the stop codon (AAUAAA here).

    ½ mark

  3. (ii) Significance: UTRs are not translated, but they are required for efficient translation of the mRNA.

    ½ mark

Answer: (i) AUG AUC UCG UAA; (ii) UTRs lie at the 5′ end before AUG and at the 3′ end after the stop codon; they are needed for efficient translation.

Where the marks are

  • Identifies the translational unit AUG AUC UCG UAA, flanked by start and stop codons (1 mark)
  • States the location of UTRs at the 5′ end (before start codon) and 3′ end (after stop codon) (0.5 mark)
  • States that UTRs are required for efficient translation (0.5 mark)

Revise the chapter

Practise this chapterBoard-style questions from Molecular Basis of Inheritance, one at a time, marked against the answer key and marking points.Back to the full paperSample paper 2024-25: every question, by section.

The question is transcribed from the official paper; figures are described in words. The solution, hints and chapter tag are ours. Spotted an error? Write tosupport@questionbuddy.in.