Skip to content

Given below is a sequence of… (Class 12 Biology 2023, Q4)

questionbuddy.in/q/cbse-12-biology-2023-57-5-1-q4-sequence-bases-mrna-bacterial-cell

BiologyCBSE Class 12 · Board exam 2023, set 57/5/1 · 1 mark · MCQ

CBSE Class 12 Biology 2023: question 4

Set in the CBSE Class 12 board exam of 2023, paper 57/5/1, section A, question 4, for 1 mark. Try it first; the hints and our step-by-step solution are below.

Q4 · 1 mark · MCQMolecular Basis of Inheritance

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.

3' AUCAGGUUUGUGAUGGUACGA 5'

  1. (A)Phenylalanine, Methionine
  2. (B)Cysteine, Glycine
  3. (C)Alanine, Proline
  4. (D)Serine, Valine

Source: official question paper from cbse.gov.in (PDF). See it in the full 2023 board paper, set 57/5/1.

Hints

Open one hint at a time and try again before the next.

Hint 1

Remember the direction in which ribosomes read mRNA.

Hint 2

Reverse the sequence so that it reads 5′→3′, then split it into triplets.

Step-by-step solution

Each step shows the marks it earns, as an examiner would award them. Checked by an independent re-solve from the question paper.

  1. Read the mRNA 5′→3′: AGC AUG GUA GUG UUU GGA CUA. Codon 3 is GUA (Valine) and codon 5 is UUU (Phenylalanine).

    ½ mark

  2. Read as written instead: AUC AGG UUU GUG AUG … gives codon 3 = UUU (Phe) and codon 5 = AUG (Met), which is option (A). Translation is always 5′→3′, so no option is strictly correct. The board awards the mark for any attempt.

    ½ mark

Answer: No correct option; mark awarded for attempting

Where the marks are

  • Award 1 mark for attempting the question (1 mark)

Revise the chapter

Practise this chapterBoard-style questions from Molecular Basis of Inheritance, one at a time, marked against the answer key and marking points.Back to the full paper2023 board paper, set 57/5/1: every question, by section.

The question is transcribed from the official paper; figures are described in words. The solution, hints and chapter tag are ours. Spotted an error? Write tosupport@questionbuddy.in.