Skip to content

Which mRNA will be… (Class 12 Biology SQP 2025-26, Q10)

questionbuddy.in/q/cbse-12-biology-2025-26-sqp-q10-mrna-translated-polypeptide-chain-containing

BiologyCBSE Class 12 · Sample paper, session 2025-26 · 1 mark · MCQ

CBSE Class 12 Biology sample paper 2025-26: question 10

From the official CBSE sample question paper for 2025-26, section A, question 10, for 1 mark. Try it first; the hints and our step-by-step solution are below.

Q10 · 1 mark · MCQMolecular Basis of Inheritance

Which mRNA will be translated to a polypeptide chain containing 8 amino acids?

  1. (A)AUGUUAAUAGACGAGUAGCGACGAUGU
  2. (B)AUGAGACGGACUGCAUUCCCAACCUGA
  3. (C)AUGCCCAACCGUUAUUCAUGCUAG
  4. (D)AUGUCGACAGUCUAAAACAGCGGG

Source: official sample paper from cbseacademic.nic.in (PDF). See it in the full Sample paper 2025-26.

Hints

Open one hint at a time and try again before the next.

Hint 1

Divide each sequence into triplets starting at AUG.

Hint 2

Stop counting at UAA, UAG or UGA.

Step-by-step solution

Each step shows the marks it earns, as an examiner would award them. Checked by an independent re-solve from the question paper.

  1. Read in triplets from AUG. (B): AUG AGA CGG ACU GCA UUC CCA ACC UGA — 8 codons before stop UGA, so 8 amino acids.

    1 mark

  2. Others: (A) stops after 5 (UAG), (C) after 7 (UAG), (D) after 4 (UAA).

Answer: (B)

Where the marks are

  • Splits into codons and counts 8 before UGA (1 mark)

Revise the chapter

Practise this chapterBoard-style questions from Molecular Basis of Inheritance, one at a time, marked against the answer key and marking points.Back to the full paperSample paper 2025-26: every question, by section.

The question is transcribed from the official paper; figures are described in words. The solution, hints and chapter tag are ours. Spotted an error? Write tosupport@questionbuddy.in.