Skip to content

I. If GUA is an… (Class 12 Biology SQP 2026-27, Q31B)

questionbuddy.in/q/cbse-12-biology-2026-27-sqp-q31b-gua-intron-how-many-amino

BiologyCBSE Class 12 · Sample paper, session 2026-27 · 5 marks · Long answer

CBSE Class 12 Biology sample paper 2026-27: question 31(B)

From the official CBSE sample question paper for 2026-27, section E, question 31(B), for 5 marks. Try it first; the hints and our step-by-step solution are below.

Q31(B) · 5 marks · Long answerCompetency-basedMolecular Basis of Inheritance

I. If GUA is an intron how many amino acids will be translated from the mature or processed RNA. Pick out the untranslated region from the following messenger RNA and mention their location and sequence. What is its significance?
5'ACGUCGAUGACCGUAGCGUUUGUAUCUUUAGUAGUGGUAUUAGUAGGCUAAAAA3'
II. If AAA is the anticodon of phenylalanine, draw the tRNA adaptor molecule, Mention the position of amino acid Phenylalanine in the sequence of polypeptide counting the triplet codons.

Source: official sample paper from cbseacademic.nic.in (PDF). See it in the full Sample paper 2026-27.

Hints

Open one hint at a time and try again before the next.

Hint 1

First find the start codon AUG and the stop codon; anything outside them is not translated.

Hint 2

Read the coding region in triplets and strike out every GUA before counting.

Hint 3

The anticodon AAA pairs with which codon? Find it in the processed mRNA.

Step-by-step solution

Each step shows the marks it earns, as an examiner would award them. Checked by an independent re-solve from the question paper.

  1. I. The coding region runs from AUG to just before the stop codon: AUG ACC GUA GCG UUU GUA UCU UUA GUA GUG GUA UUA GUA GGC (14 codons). Removing the five GUA introns leaves the mature RNA AUG ACC GCG UUU UCU UUA GUG UUA GGC, so 9 amino acids will be translated.

    1 mark

  2. Untranslated regions (UTRs):

    • At the 5' end, before the start codon AUG: 5'-ACGUCG.
    • At the 3' end, from the stop codon onwards: UAAAAA-3'.
    2 marks

  3. Significance: the UTRs are not translated but are required for an efficient translation process.

    ½ mark

  4. II. The tRNA adaptor is drawn as a clover leaf. Its anticodon loop carries the anticodon 3'-AAA-5', which pairs with the mRNA codon 5'-UUU-3'. The amino acid acceptor end (3' CCA end) carries phenylalanine. The other loops/arms are also shown.

    1 mark

  5. In the mature mRNA (AUG, ACC, GCG, UUU, …), phenylalanine is coded by the 4th triplet codon.

    ½ mark

Answer: I. 9 amino acids; UTRs: 5'-ACGUCG at the 5' end and UAAAAA-3' at the 3' end; needed for efficient translation. II. Clover-leaf tRNA with anticodon AAA carrying Phe at the 3' CCA end; Phe is at the 4th codon.

Where the marks are

  • Correct count of 9 amino acids after removing the GUA introns (1 mark)
  • Locates and writes the 5' UTR (ACGUCG) and 3' UTR (UAAAAA) (2 marks)
  • UTRs are required for efficient translation (0.5 mark)
  • Labelled clover-leaf tRNA with anticodon AAA and Phe at the amino acid acceptor end (1 mark)
  • Phe at the 4th codon position (0.5 mark)

Revise the chapter

Practise this chapterBoard-style questions from Molecular Basis of Inheritance, one at a time, marked against the answer key and marking points.Back to the full paperSample paper 2026-27: every question, by section.

The question is transcribed from the official paper; figures are described in words. The solution, hints and chapter tag are ours. Spotted an error? Write tosupport@questionbuddy.in.